ID: 1161768153_1161768158

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1161768153 1161768158
Species Human (GRCh38) Human (GRCh38)
Location 19:6217933-6217955 19:6217949-6217971
Sequence CCAGCTGCTCTCCATACACACCT CACACCTTGGCTGTGGTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 740} {0: 1, 1: 0, 2: 1, 3: 38, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!