ID: 1161780545_1161780551

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1161780545 1161780551
Species Human (GRCh38) Human (GRCh38)
Location 19:6288967-6288989 19:6289008-6289030
Sequence CCTTTGCCAACATTGTAGGATTG CCTTCTCAGGAGAAGCTGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 19, 3: 39, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!