ID: 1161807968_1161807977

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1161807968 1161807977
Species Human (GRCh38) Human (GRCh38)
Location 19:6456066-6456088 19:6456093-6456115
Sequence CCAGGCAGAGAACCCAGCAGAAG CTGTGTGGGTGGAAGGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 439} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!