ID: 1161815201_1161815207

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1161815201 1161815207
Species Human (GRCh38) Human (GRCh38)
Location 19:6495598-6495620 19:6495629-6495651
Sequence CCATCATGTTCTTGGCATCGAAC GGTGAGCTCGGGCACCGTCAGGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 16, 3: 12, 4: 90} {0: 1, 1: 3, 2: 0, 3: 16, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!