ID: 1161822625_1161822631

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1161822625 1161822631
Species Human (GRCh38) Human (GRCh38)
Location 19:6539671-6539693 19:6539710-6539732
Sequence CCACTGCAATCCGCTCTGTGTGA CTCCAAAAGAAGTGAGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 288, 4: 8714} {0: 1, 1: 0, 2: 1, 3: 20, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!