ID: 1161836649_1161836656

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1161836649 1161836656
Species Human (GRCh38) Human (GRCh38)
Location 19:6652115-6652137 19:6652144-6652166
Sequence CCTGGCTTGTGGGTGAAACACCC TTTCACCATATTGGTTAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!