ID: 1161842732_1161842741

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1161842732 1161842741
Species Human (GRCh38) Human (GRCh38)
Location 19:6692799-6692821 19:6692820-6692842
Sequence CCCAGCCCAATCTTTGCAAAGGG GGAATTGGGCAGTGGGCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 149} {0: 1, 1: 0, 2: 0, 3: 37, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!