ID: 1161847699_1161847704

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1161847699 1161847704
Species Human (GRCh38) Human (GRCh38)
Location 19:6721066-6721088 19:6721081-6721103
Sequence CCAGAGGCTTCCATGCTGAGGGA CTGAGGGAGGGGAAGTAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 87, 4: 764}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!