ID: 1161849624_1161849627

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1161849624 1161849627
Species Human (GRCh38) Human (GRCh38)
Location 19:6731708-6731730 19:6731721-6731743
Sequence CCAACAGGGCAGAGAGGCCAGAT GAGGCCAGATAAAGGCATTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 250} {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!