ID: 1161851451_1161851464

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1161851451 1161851464
Species Human (GRCh38) Human (GRCh38)
Location 19:6739896-6739918 19:6739941-6739963
Sequence CCTGGGTCCCCGCCCTCCACCCT TGGGAGTCTCAGCACGCTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 684} {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!