ID: 1161868312_1161868317

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1161868312 1161868317
Species Human (GRCh38) Human (GRCh38)
Location 19:6850858-6850880 19:6850897-6850919
Sequence CCCCTCCAGTGGCACTACAGTGC ATGCTCTTAATGATGAACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94} {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!