ID: 1161887040_1161887046

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1161887040 1161887046
Species Human (GRCh38) Human (GRCh38)
Location 19:7005121-7005143 19:7005159-7005181
Sequence CCAGGATCTGATAGCCGGCCATG TTTTCAACAACGATGGGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55} {0: 1, 1: 0, 2: 2, 3: 4, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!