ID: 1161939757_1161939764

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1161939757 1161939764
Species Human (GRCh38) Human (GRCh38)
Location 19:7395075-7395097 19:7395113-7395135
Sequence CCCCGCCTCCGAGGCGGGATCGC CTCGCGCGGCTTCCCGCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 513} {0: 1, 1: 0, 2: 1, 3: 3, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!