ID: 1161939759_1161939764

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1161939759 1161939764
Species Human (GRCh38) Human (GRCh38)
Location 19:7395077-7395099 19:7395113-7395135
Sequence CCGCCTCCGAGGCGGGATCGCGC CTCGCGCGGCTTCCCGCTTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!