ID: 1161939833_1161939855

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1161939833 1161939855
Species Human (GRCh38) Human (GRCh38)
Location 19:7395335-7395357 19:7395383-7395405
Sequence CCCCCGGGGCTGCCTCGGGCCTC AGGCAGGCGAACGGGTGCTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!