ID: 1161953826_1161953838

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1161953826 1161953838
Species Human (GRCh38) Human (GRCh38)
Location 19:7482166-7482188 19:7482212-7482234
Sequence CCAGGTTCCCTAGGACGGAGACA CTGCAGGACCAGGAGCAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83} {0: 1, 1: 0, 2: 4, 3: 66, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!