ID: 1161958059_1161958069

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1161958059 1161958069
Species Human (GRCh38) Human (GRCh38)
Location 19:7507113-7507135 19:7507136-7507158
Sequence CCCCGGTGACTGAAGAGATGCTA CAGCGGGTAAGGGAGGCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73} {0: 1, 1: 1, 2: 1, 3: 21, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!