ID: 1161967490_1161967493

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1161967490 1161967493
Species Human (GRCh38) Human (GRCh38)
Location 19:7556539-7556561 19:7556552-7556574
Sequence CCATCGGGTCTTCCAGGATAAGC CAGGATAAGCAGATTGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74} {0: 1, 1: 0, 2: 0, 3: 15, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!