ID: 1161979753_1161979768

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1161979753 1161979768
Species Human (GRCh38) Human (GRCh38)
Location 19:7624271-7624293 19:7624308-7624330
Sequence CCCCACCAGCCGGGGCCCCCAGA CTCGCGCCCCAGCTCCGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 351} {0: 1, 1: 0, 2: 0, 3: 9, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!