ID: 1161982535_1161982549

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1161982535 1161982549
Species Human (GRCh38) Human (GRCh38)
Location 19:7637396-7637418 19:7637429-7637451
Sequence CCGGACTCCGGGGACCCAAAGGG GTGTGGCGGAGGCTGGGGCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 10, 3: 60, 4: 986}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!