ID: 1162001101_1162001109

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1162001101 1162001109
Species Human (GRCh38) Human (GRCh38)
Location 19:7745614-7745636 19:7745665-7745687
Sequence CCTGGTAGATCTCCTGCTGCTTA CCTTCAGCCGGGTCAGCTCCTGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 9, 3: 7, 4: 126} {0: 6, 1: 6, 2: 1, 3: 18, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!