ID: 1162003537_1162003542

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1162003537 1162003542
Species Human (GRCh38) Human (GRCh38)
Location 19:7763445-7763467 19:7763471-7763493
Sequence CCAGCAGATACATGGCCACAAGA CTACAGGTAGGCAAGAGTTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124} {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!