ID: 1162003970_1162003988

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1162003970 1162003988
Species Human (GRCh38) Human (GRCh38)
Location 19:7765383-7765405 19:7765436-7765458
Sequence CCTGGGGGTCTGTAGGGGCCTCT CAGGAGAGGGAGGAGGAGGAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 205} {0: 1, 1: 6, 2: 167, 3: 1205, 4: 5317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!