ID: 1162031831_1162031841

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1162031831 1162031841
Species Human (GRCh38) Human (GRCh38)
Location 19:7920820-7920842 19:7920856-7920878
Sequence CCGGGGGCGGGGCGTGCGTGCCG AGTGGGTGGGTGAGTTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 228} {0: 1, 1: 0, 2: 4, 3: 39, 4: 527}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!