ID: 1162033180_1162033187

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1162033180 1162033187
Species Human (GRCh38) Human (GRCh38)
Location 19:7925978-7926000 19:7925997-7926019
Sequence CCCGGACGGGGACCGACCGCCCG CCCGGCGGCCGCGCTCTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 62} {0: 1, 1: 0, 2: 0, 3: 20, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!