ID: 1162045443_1162045448

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1162045443 1162045448
Species Human (GRCh38) Human (GRCh38)
Location 19:7996799-7996821 19:7996839-7996861
Sequence CCAGACTCCATCTCCAAAAACCA AAACAACCTGGTTTCAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 129, 3: 1336, 4: 3217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!