ID: 1162065621_1162065628

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1162065621 1162065628
Species Human (GRCh38) Human (GRCh38)
Location 19:8123698-8123720 19:8123736-8123758
Sequence CCAAACACACTTCCCATCTCCAG GTGCCCCTCCCCATCCTTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 391} {0: 1, 1: 0, 2: 5, 3: 32, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!