ID: 1162066918_1162066929

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1162066918 1162066929
Species Human (GRCh38) Human (GRCh38)
Location 19:8131498-8131520 19:8131534-8131556
Sequence CCGATGGAGGCATTCAGACCAAG CCGGGCAGCCGGATGCTCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128} {0: 1, 1: 1, 2: 0, 3: 3, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!