ID: 1162086826_1162086833

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1162086826 1162086833
Species Human (GRCh38) Human (GRCh38)
Location 19:8254453-8254475 19:8254501-8254523
Sequence CCATCTCTTCACCTGGGCTGATA TCATTGGCCTGCCCCTGAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 198} {0: 1, 1: 0, 2: 1, 3: 14, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!