ID: 1162094524_1162094538

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1162094524 1162094538
Species Human (GRCh38) Human (GRCh38)
Location 19:8302661-8302683 19:8302714-8302736
Sequence CCCACCAAGCTCCATACACATGG ACCCACCTCCCCTGAATCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117} {0: 1, 1: 0, 2: 0, 3: 31, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!