ID: 1162100136_1162100145

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1162100136 1162100145
Species Human (GRCh38) Human (GRCh38)
Location 19:8334333-8334355 19:8334352-8334374
Sequence CCCCAACAAACTGCAGGCTCTTG CTTGGGTCCGGAGCTGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 169} {0: 1, 1: 0, 2: 0, 3: 15, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!