ID: 1162106738_1162106743

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1162106738 1162106743
Species Human (GRCh38) Human (GRCh38)
Location 19:8374261-8374283 19:8374289-8374311
Sequence CCTCATGGTGCTGGTGCTGTTGT GGTCCCCTGGGGACACAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 317} {0: 1, 1: 0, 2: 0, 3: 15, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!