ID: 1162141153_1162141157

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1162141153 1162141157
Species Human (GRCh38) Human (GRCh38)
Location 19:8586292-8586314 19:8586315-8586337
Sequence CCAGAGAACCTCAGCCCAGGTAT CTTGTGCCTTCCCCCACCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 151} {0: 1, 1: 0, 2: 2, 3: 48, 4: 613}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!