ID: 1162153286_1162153291

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1162153286 1162153291
Species Human (GRCh38) Human (GRCh38)
Location 19:8660312-8660334 19:8660336-8660358
Sequence CCTACTGTGTGTCAGGTGCTGTT TGGGCACTGTAGACACAGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 34, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!