ID: 1162166895_1162166903

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1162166895 1162166903
Species Human (GRCh38) Human (GRCh38)
Location 19:8759687-8759709 19:8759715-8759737
Sequence CCTTTTCCCTTCCCCTCTCTCCA CACCCACACATCCCACAGGCAGG
Strand - +
Off-target summary No data {0: 6, 1: 0, 2: 4, 3: 32, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!