ID: 1162170647_1162170654

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1162170647 1162170654
Species Human (GRCh38) Human (GRCh38)
Location 19:8786215-8786237 19:8786237-8786259
Sequence CCCTTCCCCTCTCTCCAACACAC CACCCACACATCCCACAGGCAGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 9, 3: 110, 4: 954} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!