ID: 1162182005_1162182018

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1162182005 1162182018
Species Human (GRCh38) Human (GRCh38)
Location 19:8876382-8876404 19:8876431-8876453
Sequence CCCTGCAGCCTGTGTACCGTGCA ACTGAGCTGCAGAGGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132} {0: 1, 1: 1, 2: 2, 3: 70, 4: 518}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!