ID: 1162184753_1162184757

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1162184753 1162184757
Species Human (GRCh38) Human (GRCh38)
Location 19:8896019-8896041 19:8896048-8896070
Sequence CCATGTTCTCCTCATACTGTAGG ATGGTGAAGTTGAGTGTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 155} {0: 1, 1: 6, 2: 1, 3: 24, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!