ID: 1162199416_1162199422

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1162199416 1162199422
Species Human (GRCh38) Human (GRCh38)
Location 19:9009888-9009910 19:9009920-9009942
Sequence CCTGCGGCGGCGACTTGCTCATT GAGAGCTGGGCACAGATACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!