ID: 1162209032_1162209035

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1162209032 1162209035
Species Human (GRCh38) Human (GRCh38)
Location 19:9077214-9077236 19:9077240-9077262
Sequence CCTGGGTGCAGACGGCTGAGGCC AATGGCGTCAGCCCCAAGTGAGG
Strand - +
Off-target summary No data {0: 10, 1: 49, 2: 46, 3: 26, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!