ID: 1162222064_1162222070

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1162222064 1162222070
Species Human (GRCh38) Human (GRCh38)
Location 19:9186144-9186166 19:9186192-9186214
Sequence CCGGTTTGTGGCTGTCTGCCACC CCCCCACCTCTGTGGCCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 227} {0: 1, 1: 4, 2: 10, 3: 61, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!