ID: 1162225858_1162225864

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1162225858 1162225864
Species Human (GRCh38) Human (GRCh38)
Location 19:9221605-9221627 19:9221652-9221674
Sequence CCTCTCAAAGTGCTGGGATTACA TCTTTTGCCCATTTTAAAATTGG
Strand - +
Off-target summary {0: 11074, 1: 304386, 2: 264969, 3: 149159, 4: 134834} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!