ID: 1162269293_1162269297

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1162269293 1162269297
Species Human (GRCh38) Human (GRCh38)
Location 19:9600944-9600966 19:9600986-9601008
Sequence CCTTCATTTCTTGTTAGGGCAGC TTGGATCCTTAATATAGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 24, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!