ID: 1162287331_1162287337

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1162287331 1162287337
Species Human (GRCh38) Human (GRCh38)
Location 19:9748935-9748957 19:9748987-9749009
Sequence CCATATGAAGACACCCTAGCTGG CTCAAACTCTACAACCGCGATGG
Strand - +
Off-target summary {0: 39, 1: 35, 2: 13, 3: 8, 4: 77} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!