| ID: 1162287331_1162287337 | View in Genome Browser | 
| Spacer: 29 | 
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1162287331 | 1162287337 | 
| Species | Human (GRCh38) | Human (GRCh38) | 
| Location | 19:9748935-9748957 | 19:9748987-9749009 | 
| Sequence | CCATATGAAGACACCCTAGCTGG | CTCAAACTCTACAACCGCGATGG | 
| Strand | - | + | 
| Off-target summary | No data | No data | 
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||