ID: 1162299821_1162299829

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1162299821 1162299829
Species Human (GRCh38) Human (GRCh38)
Location 19:9838212-9838234 19:9838263-9838285
Sequence CCTGTCTGCTCTCACCTAGAATG CTGCCACATTGGCCCACGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 141} {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!