ID: 1162301552_1162301555

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1162301552 1162301555
Species Human (GRCh38) Human (GRCh38)
Location 19:9847819-9847841 19:9847842-9847864
Sequence CCTCTTCTTGGGTGTGGGTGAGG ACAGGTGTGACTGCGCATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 45, 4: 368} {0: 1, 1: 0, 2: 0, 3: 14, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!