ID: 1162322615_1162322632

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1162322615 1162322632
Species Human (GRCh38) Human (GRCh38)
Location 19:9978942-9978964 19:9978994-9979016
Sequence CCCTTCTTTCCCAAGGGGTCCTG AAGGAGGGAAGTCAAGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 305} {0: 1, 1: 0, 2: 1, 3: 13, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!