ID: 1162329218_1162329223

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1162329218 1162329223
Species Human (GRCh38) Human (GRCh38)
Location 19:10017129-10017151 19:10017148-10017170
Sequence CCCTCACCGTGGCCCAGCTGGAC GGACGTGTGCAGTGATGAGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 182} {0: 1, 1: 0, 2: 0, 3: 12, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!