ID: 1162331483_1162331501

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1162331483 1162331501
Species Human (GRCh38) Human (GRCh38)
Location 19:10032594-10032616 19:10032636-10032658
Sequence CCTTCGGCTCCTGCCACCTCTCG GGGGCAGGGGGACCGGCCACGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!