ID: 1162335704_1162335714

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1162335704 1162335714
Species Human (GRCh38) Human (GRCh38)
Location 19:10058959-10058981 19:10058992-10059014
Sequence CCCTAGTGGGTGTGGGATGCTTC TCAGTCATGGAGTGGGGAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 107} {0: 1, 1: 0, 2: 5, 3: 50, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!